disp1

Ensembl ID:
ENSDARG00000044417
ZFIN IDs:
ZDB-GENE-030911-7, ZDB-GENE-030911-7, ZDB-GENE-030911-7
Description:
Protein dispatched homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6R5J2]
Human Orthologue:
DISP1
Human Description:
dispatched homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19711]
Mouse Orthologue:
Disp1
Mouse Description:
dispatched homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916147]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23822 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065231 Nonsense 746 1464 9 9
ENSDART00000074150 Nonsense 746 1464 8 8
ENSDART00000099486 Nonsense 214 932 4 4
Genomic Location (Zv9):
Chromosome 20 (position 51828889)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 51678328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTCTCAGAATTTCAAGTGTTTCGCTCCTCGCATCCCTTTGAACGCTA[T/G]GATGCGGAGTACAAAAAACTCTTCATGTTTGAACGGGTCAACCATGGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link