cldn2

Ensembl ID:
ENSDARG00000044387
ZFIN ID:
ZDB-GENE-040912-26
Description:
claudin 2 [Source:RefSeq peptide;Acc:NP_001004559]
Human Orthologue:
CLDN2
Human Description:
claudin 2 [Source:HGNC Symbol;Acc:2041]
Mouse Orthologue:
Cldn2
Mouse Description:
claudin 2 Gene [Source:MGI Symbol;Acc:MGI:1276110]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43695 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065183 Nonsense 138 270 2 2
Genomic Location (Zv9):
Chromosome 21 (position 36971497)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37960535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCCATGTTCCTCCTGGCTGGGCTTTTATCGTTGATTCCCGTCGCCTG[G/A]AAGACCCACGAAGTGGTGCAGACCTTCTACATGCCCAACATGCCAGCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatitis: Common genetic variants in the CLDN2 and PRSS1-PRSS2 loci alter risk for alcohol-related and sporadic pancreatitis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link