atg4c

Ensembl ID:
ENSDARG00000044373
ZFIN ID:
ZDB-GENE-040625-84
Description:
cysteine protease ATG4C [Source:RefSeq peptide;Acc:NP_001002103]
Human Orthologue:
ATG4C
Human Description:
ATG4 autophagy related 4 homolog C (S. cerevisiae) [Source:HGNC Symbol;Acc:16040]
Mouse Orthologue:
Atg4c
Mouse Description:
autophagy-related 4C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2651854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13109 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051779 Essential Splice Site 410 463 10 11
ENSDART00000127879 Essential Splice Site 410 463 9 11

The following transcripts of ENSDARG00000044373 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 31995864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAAAAAGTGTTGAACACTTTGAAAAAATTGCCAATGAACTGTCAAAG[G/A]TGAGAAAACTNNNNNNNAATGTTTTAACATTAATATTGTTTTGATAAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d0dp4d5a