tbc1d23

Ensembl ID:
ENSDARG00000044357
ZFIN ID:
ZDB-GENE-040426-1253
Description:
TBC1 domain family member 23 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXV1]
Human Orthologue:
TBC1D23
Human Description:
TBC1 domain family, member 23 [Source:HGNC Symbol;Acc:25622]
Mouse Orthologue:
Tbc1d23
Mouse Description:
TBC1 domain family, member 23 Gene [Source:MGI Symbol;Acc:MGI:1914831]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26757 Essential Splice Site Mutation detected in F1 DNA During 2015
sa17445 Nonsense Available for shipment Available now
sa13842 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065138 Essential Splice Site 254 680 7 18
ENSDART00000126418 Essential Splice Site 254 527 7 16
ENSDART00000126524 Essential Splice Site 254 680 8 19
Genomic Location:
Chromosome 6 (position 28643548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATAACATCCTTATCCAAGAAGGAGACAACAAAGAGGAGATAATCAG[T/A]AAATTCTTCAGCAAATTATTTAATTAGAAAATGCAATATTTTATGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065138 Nonsense 271 680 8 18
ENSDART00000126418 Nonsense 271 527 8 16
ENSDART00000126524 Nonsense 271 680 9 19
Genomic Location:
Chromosome 6 (position 28640643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCTGGAGCAGTCGCMGTCATTACTAGAGGCAGWGGACATTGAAGACT[T/A]GTTCTCTYTAGCGCAGTATTAMAACAGCAAGACGCCTCTATCTCTTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065138 Nonsense 278 680 8 18
ENSDART00000126418 Nonsense 278 527 8 16
ENSDART00000126524 Nonsense 278 680 9 19
Genomic Location:
Chromosome 6 (position 28640621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTAGAGGCAGAGGACATTGAAGACTWGTTCTCTYTAGCGCAGTATTA[C/A]AACAGCAAGACGCCTCTATCTCTTAGAAAGGTAAGCRTTATATCAGTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sayrmbj2