tp63

Ensembl ID:
ENSDARG00000044356
ZFIN ID:
ZDB-GENE-030819-1
Description:
tumor protein 63 isoform alpha 2 [Source:RefSeq peptide;Acc:NP_689454]
Human Orthologue:
TP63
Human Description:
tumor protein p63 [Source:HGNC Symbol;Acc:15979]
Mouse Orthologue:
Trp63
Mouse Description:
transformation related protein 63 Gene [Source:MGI Symbol;Acc:MGI:1330810]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2525 Missense Available for shipment Available now
sa12599 Nonsense Available for shipment Available now
sa15970 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu2525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065135 None None 434 None 11
ENSDART00000065137 None None 588 None 12
ENSDART00000123189 None None 440 None 10
ENSDART00000127965 Missense 48 632 4 15
ENSDART00000130799 None None 576 None 12
Genomic Location:
Chromosome 6 (position 28572563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAATGCAGCCTATCGAGCTCAATTTCTCTGAGGGCTCTTCGGTCGGAT[C/T]AGCATCCAATACTATACAGATTAGCATGGACTGCATCACAATGCATGGGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065135 Nonsense 147 434 3 11
ENSDART00000065137 Nonsense 147 588 3 12
ENSDART00000123189 Nonsense 147 440 3 10
ENSDART00000127965 Nonsense 203 632 6 15
ENSDART00000130799 Nonsense 147 576 3 12
Genomic Location:
Chromosome 6 (position 28611435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCATGCCTGTCTATAAGAAAGCAGAGCATGTTACTGAGGTGGTCAAA[C/T]GMTGCCCGAACCAYGAGCTGAGCAGAGAGTTCAATGACGGTATGCCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065135 Nonsense 312 434 8 11
ENSDART00000065137 Nonsense 312 588 8 12
ENSDART00000123189 Nonsense 316 440 8 10
ENSDART00000127965 Nonsense 368 632 11 15
ENSDART00000130799 Nonsense 312 576 8 12
Genomic Location:
Chromosome 6 (position 28615154)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCCATCNNNNCTCTCTCTCTCWGTGCTTCAGATTAAAGGCCGTGAAATCTA[T/G]GAGATTTTGGTGAAAATCAAAGAGTCTTTGGAACTCATGCAGTTCCTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4j413kmm