CHRNA10 (1 of 2)

Ensembl ID:
ENSDARG00000044353
Description:
cholinergic receptor, nicotinic, alpha 10 [Source:HGNC Symbol;Acc:13800]
Human Orthologue:
CHRNA10
Human Description:
cholinergic receptor, nicotinic, alpha 10 [Source:HGNC Symbol;Acc:13800]
Mouse Orthologue:
Chrna10
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 10 Gene [Source:MGI Symbol;Acc:MGI:3609260]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11261 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012037 Nonsense 350 513 4 4
Genomic Location:
Chromosome 21 (position 39174907)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTYAACTACCTGGCTCGGTTTTGCTTCGTCTACGATATGGGACAGAGCTG[T/A]GTGTCCGTTCACACAGATCAACCAGCGAAGAAGGGAAACAACTGCACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gacoiejh