cyfip1

Ensembl ID:
ENSDARG00000044345
ZFIN ID:
ZDB-GENE-030131-8557
Description:
Cytoplasmic FMR1-interacting protein 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q90YM8]
Human Orthologue:
CYFIP1
Human Description:
cytoplasmic FMR1 interacting protein 1 [Source:HGNC Symbol;Acc:13759]
Mouse Orthologue:
Cyfip1
Mouse Description:
cytoplasmic FMR1 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1338801]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14676 Essential Splice Site Available for shipment Available now
sa20750 Nonsense Mutation detected in F1 DNA During 2014
sa10367 Nonsense Available for shipment Available now
sa2288 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065127 Essential Splice Site 70 1253 4 31
ENSDART00000104233 Essential Splice Site 70 1257 3 31
ENSDART00000122199 Essential Splice Site 70 476 4 15
ENSDART00000124610 Essential Splice Site 70 1014 4 26
ENSDART00000130905 Essential Splice Site 70 511 4 15

The following transcripts of ENSDARG00000044345 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 37620275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGCATAAACGCRTRTAAGTGTAATGATGAACTGTTTGCTGTRCATTAC[A/T]GAATGACATGTTAGAAGAAGGTCAGCAGTATGCWGTGATGCTGTACACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065127 Nonsense 79 1253 4 31
ENSDART00000104233 Nonsense 79 1257 3 31
ENSDART00000122199 Nonsense 79 476 4 15
ENSDART00000124610 Nonsense 79 1014 4 26
ENSDART00000130905 Nonsense 79 511 4 15

The following transcripts of ENSDARG00000044345 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 37620306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTTTGCTGTGCATTACAGAATGACATGTTAGAAGAAGGTCAGCAGTA[T/A]GCTGTGATGCTGTACACGTGGAGGTGCTGTTCGAGAGCTATTCCTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065127 Nonsense 580 1253 16 31
ENSDART00000104233 Nonsense 584 1257 16 31
ENSDART00000122199 None None 476 None 15
ENSDART00000124610 Nonsense 580 1014 16 26
ENSDART00000130905 None None 511 None 15

The following transcripts of ENSDARG00000044345 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 37645902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAATGCTGGAGTCTCTGGTCGCAGATAAGAGCGGATCAAAGAAGACCT[T/A]GCGCAGTAGTCTRGAGGGGCCGACCAYTCWKGACATCGAGAAGTTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2288
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065127 Nonsense 919 1253 24 31
ENSDART00000104233 Nonsense 923 1257 24 31
ENSDART00000122199 None None 476 None 15
ENSDART00000124610 Nonsense 919 1014 24 26
ENSDART00000130905 None None 511 None 15

The following transcripts of ENSDARG00000044345 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 37663785)
KASP Assay ID:
554-2555.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCCTCTACCGCAACTTTGTGGGACCTCCACATATTAAGGCTATTTGC[A/T]GACTTCTGGGATACCAGGGAATCGCTGTGGTGATGGAGGAGCTGTTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sug7dvve