LOC563748

Ensembl ID:
ENSDARG00000044341
Human Orthologue:
CHST7
Human Description:
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7 [Source:HGNC Symbol;Acc:13817]
Mouse Orthologue:
Chst7
Mouse Description:
carbohydrate (N-acetylglucosamino) sulfotransferase 7 Gene [Source:MGI Symbol;Acc:MGI:1891767]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2299 Nonsense F2 line generated During 2014
sa8237 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2299
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065119 Nonsense 230 428 1 1
Genomic Location:
Chromosome 6 (position 37569769)
KASP Assay ID:
554-2757.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGAGTGTAAAAAGTACCCGGTGATGGTGATCAAAGACGTGCGGGTTT[T/A]GGACTTGGCGGTTCTGGTGCCTCTCATGCGAGACCCCGCCATCAACCTYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065119 Nonsense 282 428 1 1
Genomic Location:
Chromosome 6 (position 37569614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGCTGGCWCTGGTGAAGGAGAGCATACAGGTGCTGAGGAGCAAGAAA[C/T]AAAGCGAGAAATACAAGCGGCTTCTGGTGCCCAGCAACAGGGTRCACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rwekbba5