rp2

Ensembl ID:
ENSDARG00000044339
ZFIN ID:
ZDB-GENE-040426-2795
Description:
protein XRP2 [Source:RefSeq peptide;Acc:NP_998611]
Human Orthologue:
RP2
Human Description:
retinitis pigmentosa 2 (X-linked recessive) [Source:HGNC Symbol;Acc:10274]
Mouse Orthologue:
Rp2h
Mouse Description:
retinitis pigmentosa 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1277953]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17284 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065117 Nonsense 76 311 2 6
ENSDART00000136920 Nonsense 141 376 2 6
Genomic Location:
Chromosome 6 (position 37470185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTTCTTCAGAGATTGTAAAGACATCAAATGCGTGGTGGCCTGTCAG[C/T]AGTTCCGCACGAGAGACTGCAAGAAAATGGACGTCTTTTTGTGCTGYGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cifn9bu1