or115-7

Ensembl ID:
ENSDARG00000044338
ZFIN ID:
ZDB-GENE-070806-9
Description:
odorant receptor, family F, subfamily 115, member 7 [Source:RefSeq peptide;Acc:NP_001030339]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32357 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065116 Nonsense 114 313 2 2
ENSDART00000139654 Nonsense 114 313 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39105290)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40245355
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCTATTCAAGCTTATTTTGTCCATGTATTTACAGCAGCATGTCACTA[T/G]GTGCTGATGATCATGGCCTTTGACAGATATGTTGCTATATGTAATCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link