or115-6

Ensembl ID:
ENSDARG00000044337
ZFIN ID:
ZDB-GENE-070806-8
Description:
odorant receptor, family F, subfamily 115, member 6 [Source:RefSeq peptide;Acc:NP_001035388]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18047 Nonsense Available for shipment Available now
sa8504 Nonsense Mutation detected in F1 DNA During 2014
sa11999 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065115 Nonsense 9 315 2 2
Genomic Location:
Chromosome 21 (position 39117354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCAGANTTTTTTGAAGAACAACTAATGGATAACTTGACAATCACAAAC[A/T]GAATTCTCCTMATAGAGGGACTGAAAGTTACACAACATTCTTCTTATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065115 Nonsense 239 315 2 2
Genomic Location:
Chromosome 21 (position 39118044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACCGTATGCATAACCAGCAAAAACAAGTCATTCAATCGAAAAGCCATA[C/T]AAACATGCGGCACACACATAGCTGTTTATTTAATCATGTTTGTTTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065115 Nonsense 241 315 2 2
Genomic Location:
Chromosome 21 (position 39118052)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATAACCAGCAAAAACAAGTCATTCAATCGAAAAGCCATAYAAACATG[C/A]GGCACACACATAGCTGTTTATTTAATCATGTTTGTTTCTTCTGTCATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0tjuny60