LOC100329397

Ensembl ID:
ENSDARG00000044328
Human Orthologue:
ANKRD46
Human Description:
ankyrin repeat domain 46 [Source:HGNC Symbol;Acc:27229]
Mouse Orthologue:
Ankrd46
Mouse Description:
ankyrin repeat domain 46 Gene [Source:MGI Symbol;Acc:MGI:1916089]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15181 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065105 Nonsense 108 228 2 3
ENSDART00000123314 Nonsense 108 254 2 4
Genomic Location:
Chromosome 21 (position 41887564)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTATTGAGTGCTTCATGTCTGTATTTCTGATCTGAACAGYAATCACAAC[G/T]GAGYCACTCCTCTGGTTCTGGCCAAGAGACGCGGCGTGAATAAAGATGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3hldgypd