ENSDARG00000044326

Ensembl ID:
ENSDARG00000044326
Human Orthologues:
GP5, LRRC15
Human Descriptions:
glycoprotein V (platelet) [Source:HGNC Symbol;Acc:4443]
leucine rich repeat containing 15 [Source:HGNC Symbol;Acc:20818]
Mouse Orthologues:
Gp5, Lrrc15
Mouse Descriptions:
glycoprotein 5 (platelet) Gene [Source:MGI Symbol;Acc:MGI:1096363]
leucine rich repeat containing 15 Gene [Source:MGI Symbol;Acc:MGI:1921738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20747 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065101 Nonsense 282 804 2 2
Genomic Location:
Chromosome 6 (position 36246717)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAGCAAAATAGTAAAACTCTTTTTGGACCATAATCTTTTGACAGAGT[T/A]GGAGCAAGAGCTATTTGTAGGTTTCATTTCATTGAAAAGTTTAACTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vapzueas