ENSDARG00000044326

Ensembl ID:
ENSDARG00000044326
Human Orthologues:
GP5, LRRC15
Human Descriptions:
glycoprotein V (platelet) [Source:HGNC Symbol;Acc:4443]
leucine rich repeat containing 15 [Source:HGNC Symbol;Acc:20818]
Mouse Orthologues:
Gp5, Lrrc15
Mouse Descriptions:
glycoprotein 5 (platelet) Gene [Source:MGI Symbol;Acc:MGI:1096363]
leucine rich repeat containing 15 Gene [Source:MGI Symbol;Acc:MGI:1921738]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33899 Nonsense Mutation detected in F1 DNA During 2017
sa20747 Nonsense Available for shipment Available now
sa44639 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065101 Nonsense 259 804 2 2
Genomic Location (Zv9):
Chromosome 6 (position 36246647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36490181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGATCTGACAGAGATAGCCTTGCAAGGCAACCAAATCTCGTCCTTA[C/T]AACCAAATTTGTTTCCACACAAAAGCAAAATAGTAAAACTCTTTTTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065101 Nonsense 282 804 2 2
Genomic Location (Zv9):
Chromosome 6 (position 36246717)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36490251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAGCAAAATAGTAAAACTCTTTTTGGACCATAATCTTTTGACAGAGT[T/A]GGAGCAAGAGCTATTTGTAGGTTTCATTTCATTGAAAAGTTTAACTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065101 Nonsense 673 804 2 2
Genomic Location (Zv9):
Chromosome 6 (position 36247889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAACAACACTACAACCAACAACTACAATTCCTACCACATCAGCACTT[C/T]AAACAACAGTTGCAACAACTTCAGTTTCTACAACCATGTTAATCCCTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link