prrc1

Ensembl ID:
ENSDARG00000044304
ZFIN ID:
ZDB-GENE-041024-9
Description:
Protein PRRC1 [Source:UniProtKB/Swiss-Prot;Acc:Q5XJA3]
Human Orthologue:
PRRC1
Human Description:
proline-rich coiled-coil 1 [Source:HGNC Symbol;Acc:28164]
Mouse Orthologue:
Prrc1
Mouse Description:
proline-rich coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1916106]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41613 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065045 Nonsense 220 435 5 9
Genomic Location (Zv9):
Chromosome 10 (position 16205437)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16218744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTTAATCACAGGGTGTTGCTGGAAACCCAATGGTCAAGACCGTCT[T/A]GGATAAAACCAAACACTCTGTGGAGTCCATGATCACCACGTTGGATCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link