pip5k1b

Ensembl ID:
ENSDARG00000044295
ZFIN ID:
ZDB-GENE-041010-81
Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, beta [Source:RefSeq peptide;Acc:NP_001005775]
Human Orthologue:
PIP5K1B
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, beta [Source:HGNC Symbol;Acc:8995]
Mouse Orthologue:
Pip5k1b
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 beta Gene [Source:MGI Symbol;Acc:MGI:107930]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34866 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21691 Nonsense Available for shipment Available now
sa15289 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065032 Essential Splice Site 23 521 2 14
ENSDART00000148169 Essential Splice Site 31 161 3 6
Genomic Location (Zv9):
Chromosome 10 (position 15935969)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15949276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCGGAGGTGAAAGACCTCAAAAAACTGTGGGAAAAGACCACAAAAAG[G/A]TATGTGCAATATAAAACAATGTTTTGTCTTTAGTTAGCTGTGATAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065032 Nonsense 78 521 4 14
ENSDART00000148169 Nonsense 86 161 5 6
Genomic Location (Zv9):
Chromosome 10 (position 15926325)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15939632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTTTGTCTTTCAGTGAAGGAAGTAATCTCACCCCGGCTCACCATTA[T/A]CCTGACTTTCGCTTCAAAAATTATGCGCCTTTGGCTTTTCGATATTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065032 Nonsense 196 521 6 14
ENSDART00000148169   None 161 None 6
Genomic Location (Zv9):
Chromosome 10 (position 15921908)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15935215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAATGAYCATMCGACTGGTGGTGATGAACAATGTTYTGCCTCGATCTT[T/A]AAAAATGGACTACAAATATGACCTGAAGGGCTCCACWTACAAACGCAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link