opn1mw1

Ensembl ID:
ENSDARG00000044280
ZFIN ID:
ZDB-GENE-990604-42
Description:
Green-sensitive opsin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q9W6A5]
Human Orthologue:
RHO
Human Description:
rhodopsin [Source:HGNC Symbol;Acc:10012]
Mouse Orthologue:
Rho
Mouse Description:
rhodopsin Gene [Source:MGI Symbol;Acc:MGI:97914]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14284 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002046 Essential Splice Site 120 349 1 5
ENSDART00000126830 Essential Splice Site 120 349 1 6
Genomic Location:
Chromosome 6 (position 41113174)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGGTCCATTAGGCTGTGTAATGGAGGGATTCTTCGCAACACTTGGAG[G/A]TAAGGAGTAACKAGCARTGCATAGATTTGAATGCAGTACATGCTGGGGYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7q8qa2wx