opn1mw3

Ensembl ID:
ENSDARG00000044279
ZFIN ID:
ZDB-GENE-030728-6
Description:
Green-sensitive opsin-3 [Source:UniProtKB/Swiss-Prot;Acc:Q8AYM7]
Human Orthologue:
RHO
Human Description:
rhodopsin [Source:HGNC Symbol;Acc:10012]
Mouse Orthologue:
Rho
Mouse Description:
rhodopsin Gene [Source:MGI Symbol;Acc:MGI:97914]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7586 Missense Mutation detected in F1 DNA During 2017
sa33931 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000877 Missense 61 349 1 5
Genomic Location (Zv9):
Chromosome 6 (position 41122578)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41194178
KASP Assay ID:
554-4211.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTTCCTCATGTGCTTTGGGTTTCCCATCAATGGCCTTACATTGGTGG[T/A]AACAGCTCAACACAAAAAGCTGAGGCAACCTCTCAACTTCATTCTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33931
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000877 Nonsense 149 349 2 5
Genomic Location (Zv9):
Chromosome 6 (position 41122917)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41194517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAGAGATACATTGTGGTTTGCAAGCCAATGGGGAGTTTCAAATTTT[C/A]ATCCAACCATGCTTTCGCTGGGATTGGATTTACATGGATAATGGCCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link