TLN2 (1 of 2)

Ensembl ID:
ENSDARG00000044271
Description:
talin 2 [Source:HGNC Symbol;Acc:15447]
Human Orthologue:
TLN2
Human Description:
talin 2 [Source:HGNC Symbol;Acc:15447]
Mouse Orthologue:
Tln2
Mouse Description:
talin 2 Gene [Source:MGI Symbol;Acc:MGI:1917799]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17241 Essential Splice Site Available for shipment Available now
sa13127 Essential Splice Site Available for shipment Available now
sa19370 Nonsense Mutation detected in F1 DNA During 2016
sa9473 Nonsense Available for shipment Available now
sa44343 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11842 Essential Splice Site Available for shipment Available now
sa32542 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Essential Splice Site 192 2010 4 43
Genomic Location (Zv9):
Chromosome 25 (position 34091397)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32565577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCAYKCAGTGYGCACTKTCCACATCACAGCTGGTGGCCTGTACTAAG[G/A]TACTWCTGACAGATGAAGAGAAATGATGCYGMTAACATTATACACAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Essential Splice Site 389 2010 7 43
Genomic Location (Zv9):
Chromosome 25 (position 34080934)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32576040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAGCTGCCCAAAACGCCATCAAAAARAAGCTCATTCACAGACTGGAG[G/A]TGAGCAGATGCATTACAGGACATGTTACAGATANNCCTGTTGAAAGTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Nonsense 703 2010 15 43
ENSDART00000023584 Nonsense 703 2010 15 43
Genomic Location (Zv9):
Chromosome 25 (position 34062492)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32594347
KASP Assay ID:
554-5506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTATCATATCTCCCTTTCTGTAATATTTCCAGCTTCCTCCATGCTCT[A/T]AATCCTTCCAAGAGGCGCAGACGGACTTGAACCACACAGCAGCCGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Nonsense 703 2010 15 43
ENSDART00000023584 Nonsense 703 2010 15 43
Genomic Location (Zv9):
Chromosome 25 (position 34062492)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32594347
KASP Assay ID:
554-5506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTATCATRTCTCCCTTTCTGTAATATTTCCAGCTTCCTCCATGCTCT[A/T]AATCCTTCCAAGAGGCGCAGACGGACTTGAACMACACAGCAGCCGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Essential Splice Site 1166 2010 24 43
Genomic Location (Zv9):
Chromosome 25 (position 34036817)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32619114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGCCGTGGGTCAGAGTTTGCCACGCAGAGATGACATTTCCCTGGAGG[T/C]AACCAATAAAATCATGTCTGTGTCAGTACCTGCCCTCTTTTCGTTACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Essential Splice Site 1627 2010 34 43
Genomic Location (Zv9):
Chromosome 25 (position 34018354)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32637633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGAGGGCTCTGGAAGCCACTATTGAGTGCATCAAACAAGAACTCACTG[T/C]ACGKAACATTATGTGTGAATATTRAWCCCTCATACTGATGTCATTTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Nonsense 1914 2010 41 43
Genomic Location (Zv9):
Chromosome 25 (position 33996869)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32659118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAACAGGTGGCGGCGTCCACTGCACAGCTGCTGGTGGCCTGCAAAGTC[A/T]AAGCAGACCAGGACTCTGAGGCCATGAGGAGATTACAGGTCAACTTTTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link