TLN2 (1 of 2)

Ensembl ID:
ENSDARG00000044271
Description:
talin 2 [Source:HGNC Symbol;Acc:15447]
Human Orthologue:
TLN2
Human Description:
talin 2 [Source:HGNC Symbol;Acc:15447]
Mouse Orthologue:
Tln2
Mouse Description:
talin 2 Gene [Source:MGI Symbol;Acc:MGI:1917799]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17241 Essential Splice Site Available for shipment Available now
sa13127 Essential Splice Site Available for shipment Available now
sa19370 Nonsense Mutation detected in F1 DNA During 2014
sa9473 Nonsense Available for shipment Available now
sa11842 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Essential Splice Site 192 2010 4 43
Genomic Location:
Chromosome 25 (position 34091397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCAYKCAGTGYGCACTKTCCACATCACAGCTGGTGGCCTGTACTAAG[G/A]TACTWCTGACAGATGAAGAGAAATGATGCYGMTAACATTATACACAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Essential Splice Site 389 2010 7 43
Genomic Location:
Chromosome 25 (position 34080934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAGCTGCCCAAAACGCCATCAAAAARAAGCTCATTCACAGACTGGAG[G/A]TGAGCAGATGCATTACAGGACATGTTACAGATANNCCTGTTGAAAGTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Nonsense 703 2010 15 43
ENSDART00000023584 Nonsense 703 2010 15 43
Genomic Location:
Chromosome 25 (position 34062492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTATCATATCTCCCTTTCTGTAATATTTCCAGCTTCCTCCATGCTCT[A/T]AATCCTTCCAAGAGGCGCAGACGGACTTGAACCACACAGCAGCCGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Nonsense 703 2010 15 43
ENSDART00000023584 Nonsense 703 2010 15 43
Genomic Location:
Chromosome 25 (position 34062492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTATCATRTCTCCCTTTCTGTAATATTTCCAGCTTCCTCCATGCTCT[A/T]AATCCTTCCAAGAGGCGCAGACGGACTTGAACMACACAGCAGCCGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023584 Essential Splice Site 1627 2010 34 43
Genomic Location:
Chromosome 25 (position 34018354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGAGGGCTCTGGAAGCCACTATTGAGTGCATCAAACAAGAACTCACTG[T/C]ACGKAACATTATGTGTGAATATTRAWCCCTCATACTGATGTCATTTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rfict1x2