cdc37l1

Ensembl ID:
ENSDARG00000044265
ZFIN ID:
ZDB-GENE-030131-8865
Description:
Hsp90 co-chaperone Cdc37-like 1 [Source:UniProtKB/Swiss-Prot;Acc:A7YY97]
Human Orthologue:
CDC37L1
Human Description:
cell division cycle 37 homolog (S. cerevisiae)-like 1 [Source:HGNC Symbol;Acc:17179]
Mouse Orthologue:
Cdc37l1
Mouse Description:
cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914322]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34859 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12517 Nonsense Available for shipment Available now
sa12498 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127331 Essential Splice Site 113 344 2 8

The following transcripts of ENSDARG00000044265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 10946230)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11022096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGCTGGGCACGCTGTGTCCTGAAGCCAACCGGGATGTGTTTGACAAG[G/A]TAGCTAAACTCTAGAAAGTCATCCAGAGAGTTGATGATGTCATCATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12517
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127331 Nonsense 161 344 4 8
ENSDART00000127331 Nonsense 161 344 4 8

The following transcripts of ENSDARG00000044265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 10946758)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11022624
KASP Assay ID:
2260-2968.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGTATGCTGGGAAGGTGGGATGACAGTCAGCGCTTTCTAGCAGAATA[T/A]CATCACCTCATCTGTGAAGAAACAGCCAATTACCTGATCCTGTGGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127331 Nonsense 161 344 4 8
ENSDART00000127331 Nonsense 161 344 4 8

The following transcripts of ENSDARG00000044265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 10946758)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11022624
KASP Assay ID:
2260-2968.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGTATGCTGGGAAGGTGGGATGACAGTCAGCGCTTTCTAGCAGAATA[T/A]CATCACCTCATCTGTGAAGAAACAGCCAATTACCTGATCCTGTGGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link