paqr3b

Ensembl ID:
ENSDARG00000044253
ZFIN ID:
ZDB-GENE-050913-128
Description:
progestin and adipoQ receptor family member IIIb [Source:RefSeq peptide;Acc:NP_001025319]
Human Orthologue:
PAQR3
Human Description:
progestin and adipoQ receptor family member III [Source:HGNC Symbol;Acc:30130]
Mouse Orthologue:
Paqr3
Mouse Description:
progestin and adipoQ receptor family member III Gene [Source:MGI Symbol;Acc:MGI:2679683]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34852 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064973 Nonsense 262 307 6 8
ENSDART00000145879 Nonsense 262 307 6 7
Genomic Location (Zv9):
Chromosome 10 (position 9320317)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 9396273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAGCCTCTGCGTTCCTTTTTTACGTCAGTAAAATCCCAGAAAGATA[C/A]TTCCCAGGTAATTTGTTTTCTAGATTACATTCCTATATAATATATATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link