rasgef1bb

Ensembl ID:
ENSDARG00000044251
ZFIN ID:
ZDB-GENE-040801-220
Description:
Ras-GEF domain-containing family member 1B-B [Source:UniProtKB/Swiss-Prot;Acc:Q6DBW1]
Human Orthologue:
RASGEF1B
Human Description:
RasGEF domain family, member 1B [Source:HGNC Symbol;Acc:24881]
Mouse Orthologue:
Rasgef1b
Mouse Description:
RasGEF domain family, member 1B Gene [Source:MGI Symbol;Acc:MGI:2443755]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13833 Essential Splice Site Available for shipment Available now
sa21670 Nonsense Available for shipment Available now
sa21671 Nonsense Mutation detected in F1 DNA During 2014
sa9906 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Essential Splice Site None 475 2 14
Genomic Location:
Chromosome 10 (position 9255209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGCTGCCATGCATCTTTCATACCTAATGACTAATGTTTTTTGWCCTY[A/T]GGWCCAACATGCCACAAACAACTCCATATTCAAGCAAATDCAATCCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Nonsense 16 475 2 14
Genomic Location:
Chromosome 10 (position 9255265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGCCACAAACAACTCCATATTCAAGCAAATTCAATCCAAGTGCTTA[C/A]AGCAGCAGCCACAGTCACCGGCAGCCTGTGGAGGAGAACTATGGGGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Nonsense 261 475 7 14
Genomic Location:
Chromosome 10 (position 9264161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTTCAGAGTTTCTTCAGTAAAAGAAAAGCAAGCAACCTGGAGGCTTA[T/A]GTCGAATGGTTCAACAGACTGAGCTACCTGACAGCCACAGAAATTTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064968 Essential Splice Site 313 475 9 14
Genomic Location:
Chromosome 10 (position 9265025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATKAAATGTTAGTGTTATATAATACTAATACAYGATCATTATTTCACTT[A/T]GCTGGAAYGAACATGAATCCAGTATCCAGACTGAAGAAAACCTGGGGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gplsfnaj