dram2

Ensembl ID:
ENSDARG00000044241
ZFIN ID:
ZDB-GENE-040625-141
Description:
DNA damage-regulated autophagy modulator protein 2 [Source:RefSeq peptide;Acc:NP_001002135]
Human Orthologue:
DRAM2
Human Description:
DNA-damage regulated autophagy modulator 2 [Source:HGNC Symbol;Acc:28769]
Mouse Orthologue:
Dram2
Mouse Description:
VDNA-damage regulated autophagy modulator 2 Gene [Source:MGI Symbol;Acc:MGI:1914421]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24049 Essential Splice Site Available for shipment Available now
sa37394 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43737 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105897 Essential Splice Site None 272 1 8
ENSDART00000146619 Essential Splice Site None 273 1 8
Genomic Location (Zv9):
Chromosome 22 (position 846195)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 849107
KASP Assay ID:
2261-6197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAAAGGGATTTAAAATGTTTCCGTTCGGACTGAGGGATGATTGACAG[G/A]TAAAGCTGTTCCTCATTGATGTACAGTAACTGTTGACATCTGACACAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105897 Essential Splice Site 114 272 4 8
ENSDART00000146619 Essential Splice Site 115 273 4 8
Genomic Location (Zv9):
Chromosome 22 (position 841272)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 844184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGGCTGCTGCAGCTCATTCGGCATGTGCGTCGTTGCTAACTTCCAG[G/A]TACGTATTTAAATTTTGGCCCCTGTATTGTTTTTTTGACTACATGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105897 Nonsense 144 272 5 8
ENSDART00000146619 Nonsense 145 273 5 8
Genomic Location (Zv9):
Chromosome 22 (position 840388)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 843300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACGTTCGGCATCGGCGCGCTCTACGTTTTCATCCAGACGGCTCTGT[C/A]GTACCTCATGCAGCCTCACATCCACAGCAAAACCATGTTCTGGACGCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link