kars

Ensembl ID:
ENSDARG00000044220
ZFIN IDs:
ZDB-GENE-021115-8, ZDB-GENE-021115-8
Description:
lysyl-tRNA synthetase [Source:RefSeq peptide;Acc:NP_001002386]
Human Orthologue:
KARS
Human Description:
lysyl-tRNA synthetase [Source:HGNC Symbol;Acc:6215]
Mouse Orthologue:
Kars
Mouse Description:
lysyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1934754]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa694 Essential Splice Site Available for shipment Available now
sa21133 Essential Splice Site Available for shipment Available now
sa21134 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa15144 Essential Splice Site Available for shipment Available now
sa2395 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064924 Essential Splice Site 15 577 1 15
ENSDART00000064926 Essential Splice Site None 602 1 15
Genomic Location:
Chromosome 7 (position 69483470)
KASP Assay ID:
554-0602.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGATGGCAGACGGAGCTGTGGTGGATGGAGACAAACTCAGCAAAAA[G/A]TATAGACATTTACACAATTATAGCGCTTAGGCTGCTTTTGTGCGAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064924 Essential Splice Site 211 577 5 15
ENSDART00000064926 Essential Splice Site 236 602 6 15
Genomic Location:
Chromosome 7 (position 69490361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCATGTCTTCATATGCTTCCACATCTTCACTTTGGCCTGAAAGACAAG[G/A]TAAAGCTTTGTTTTTAAATCACTTTGGAAATAATATCTCTCTTTCAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064924 Splice Site, Nonsense 406 577 9 15
ENSDART00000064926 Splice Site, Nonsense 431 602 10 15
Genomic Location:
Chromosome 7 (position 69497597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGGAGTTGGGTGTGAAGTTTCCACCTCCTGACACCTATGACAGTGAC[G/T]GTATAGAAATGTTTGAAAACATATGTTTGCCATCACAAAAGGTGTGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064924 Essential Splice Site 406 577 9 15
ENSDART00000064926 Essential Splice Site 431 602 10 15
Genomic Location:
Chromosome 7 (position 69497599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGTTGGGTGTGAARTTTCCACCTCCTGACACCTATGACAGTGACGG[T/C]AWAGNAAATGTTTGAAAACATATGTTTGCCATCACAAAAGGTGTGGGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064924 Nonsense 525 577 13 15
ENSDART00000064926 Nonsense 550 602 14 15
Genomic Location:
Chromosome 7 (position 69500282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGTGACGAYGAGGCCATGTTCAYTGATGAGACCTTCTGYACCGCTT[T/A]AGAGTACGGTCTTCCCCCCACAGCAGGATGGGGAATGGGCATCGACCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7rksh64y