fto

Ensembl ID:
ENSDARG00000044216
ZFIN ID:
ZDB-GENE-061108-1
Description:
Fto protein [Source:UniProtKB/TrEMBL;Acc:Q568I7]
Human Orthologue:
FTO
Human Description:
fat mass and obesity associated [Source:HGNC Symbol;Acc:24678]
Mouse Orthologue:
Fto
Mouse Description:
fat mass and obesity associated Gene [Source:MGI Symbol;Acc:MGI:1347093]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12749 Nonsense Available for shipment Available now
e37 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa12749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064913 Nonsense 119 568 3 9
ENSDART00000130028 Nonsense 131 579 3 10
Genomic Location:
Chromosome 7 (position 37641209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACGTACCGTTATCTGGACACTCGTCTGTTCACCATCCCCTGGCACTG[T/A]GAAGGAGAAGAGGGCCAGAAAGATGAGAAAGGCAAACCTTGCTGTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
e37
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064913 Nonsense 372 568 5 9
ENSDART00000130028 Nonsense 384 579 5 10
Genomic Location:
Chromosome 7 (position 37629518)
KASP Assay ID:
554-0074.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTTGCGTTGTATGCACAGATGATCTGAACCGGACACATCAGCACTG[T/A]GTACTGGCTGGTGACACAGCTAGATTCAGCTCAACTCACAGAGTCGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiposity: Genetic variation near IRS1 associates with reduced adiposity and an impaired metabolic profile. (View Study)
  • Body mass in chronic obstructive pulmonary disease: Genome-wide association analysis of body mass in chronic obstructive pulmonary disease. (View Study)
  • Body mass index: A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. (View Study)
  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)
  • Body mass index: Common variants near MC4R are associated with fat mass, weight and risk of obesity. (View Study)
  • Body mass index: FTO genotype is associated with phenotypic variability of body mass index. (View Study)
  • Body mass index: Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. (View Study)
  • Height: A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. (View Study)
  • Melanoma: A variant in FTO shows association with melanoma risk not due to BMI. (View Study)
  • Menarche (age at onset): Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies. (View Study)
  • Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)
  • Obesity: Genome-wide association study for early-onset and morbid adult obesity identifies three new risk loci in European populations. (View Study)
  • Obesity: Replication of 13 obesity loci among Singaporean Chinese, Malay and Asian-Indian populations. (View Study)
  • Obesity (early onset extreme): Genome wide association (GWA) study for early onset extreme obesity supports the role of fat mass and obesity associated gene (FTO) variants. (View Study)
  • Obesity (extreme): Common body mass index-associated variants confer risk of extreme obesity. (View Study)
  • Obesity (extreme): Two new Loci for body-weight regulation identified in a joint analysis of genome-wide association studies for early-onset extreme obesity in French and german study groups. (View Study)
  • Obesity-related traits: Genome-wide association scan shows genetic variants in the FTO gene are associated with obesity-related traits. (View Study)
  • Osteoarthritis: Identification of new susceptibility loci for osteoarthritis (arcOGEN): a genome-wide association study. (View Study)
  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)
  • Type 2 diabetes: A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. (View Study)
  • Type 2 diabetes: Adiposity-related heterogeneity in patterns of type 2 diabetes susceptibility observed in genome-wide association data. (View Study)
  • Type 2 diabetes: Genome-wide association study for type 2 diabetes in Indians identifies a new susceptibility locus at 2q21. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: Stratifying type 2 diabetes cases by BMI identifies genetic risk variants in LAMA1 and enrichment for risk variants in lean compared to obese cases. (View Study)
  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
  • Waist circumference: NRXN3 is a novel locus for waist circumference: a genome-wide association study from the CHARGE Consortium. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h2ozey54