lpar1

Ensembl ID:
ENSDARG00000044213
ZFIN IDs:
ZDB-GENE-030616-499, ZDB-GENE-030616-499
Description:
lysophosphatidic acid receptor 1 [Source:RefSeq peptide;Acc:NP_001004502]
Human Orthologue:
LPAR1
Human Description:
lysophosphatidic acid receptor 1 [Source:HGNC Symbol;Acc:3166]
Mouse Orthologue:
Lpar1
Mouse Description:
lysophosphatidic acid receptor 1 Gene [Source:MGI Symbol;Acc:MGI:108429]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38782 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064918 Nonsense 5 346 2 3
ENSDART00000129261 Nonsense 5 346 1 2
Genomic Location (Zv9):
Chromosome 10 (position 12098517)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 13079285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGTATCTTTATTTTTCAGAAACAGACCTTTCAGGATGGATGATAGA[C/T]AATGCTACTACAACGAAACCATAGCCTTTTTTTACAATCGTAGTCAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link