ENSDARG00000044212

Ensembl ID:
ENSDARG00000044212
Human Orthologues:
CCDC88A, CCDC88C
Human Descriptions:
coiled-coil domain containing 88A [Source:HGNC Symbol;Acc:25523]
coiled-coil domain containing 88C [Source:HGNC Symbol;Acc:19967]
Mouse Orthologues:
Ccdc88a, Ccdc88c
Mouse Descriptions:
coiled coil domain containing 88A Gene [Source:MGI Symbol;Acc:MGI:1925177]
coiled-coil domain containing 88C Gene [Source:MGI Symbol;Acc:MGI:1915589]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6565 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29244 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29245 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36886 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43324 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43325 Nonsense Mutation detected in F1 DNA During 2016
sa23573 Nonsense Available for shipment Available now
sa23574 Nonsense Available for shipment Available now
sa23575 Nonsense Available for shipment Available now
sa36887 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43326 Nonsense Mutation detected in F1 DNA During 2016
sa36888 Nonsense Available for shipment Available now
sa32251 Nonsense Available for shipment Available now
sa43327 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 86 2343 3 41
Genomic Location (Zv9):
Chromosome 19 (position 39081478)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37945461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAAGAAAAGACATAGAGAAGATGAAAAAGAACATCWCAAGAGAAATG[C/G]ATGARATCAAACATCAAGARGAACAAATKAAACAAAAACAAGATGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 128 2343 3 41
Genomic Location (Zv9):
Chromosome 19 (position 39081606)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37945589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAACAAGAACTAGAAAAAGAAAAAGAGATTATCATGAAGGCCAGAAG[T/G]CAGCTTGATCTGAGACAATCTGAACTAGATAAACAACAGACAAACATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 128 2343 4 41
Genomic Location (Zv9):
Chromosome 19 (position 39082828)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37946811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAAGATCCTGGATAAAATGAAAGTTGCAAACGAGTCTTTAATGGCA[G/A]ATCTGCAAAAAGAAAAGAGCAATCTTGAGGAAATGAGAGAAAACATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 374 2343 7 41
Genomic Location (Zv9):
Chromosome 19 (position 39084042)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37948025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGATCTTGCTGAAGAAACAAAGAAAAATAATCAAGTCTTGGATGAAAT[G/A]AAAGTTGCAAACGAGTCTACACTGGCAGATATATTAAGAGAAAAGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 516 2343 11 41
Genomic Location (Zv9):
Chromosome 19 (position 39086689)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37950672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGAGATTCTGGATAAAGTAAAAGTTGCAAACGAGTCTTTAATGGCA[G/A]ATCTGCAAAAAGAAAAGAGCAATCTTGAGGAAATGAGAGAAAACATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 1193 2343 22 41
Genomic Location (Zv9):
Chromosome 19 (position 39091927)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37955910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATGCAGAGAGAAAGTCTGAAAATTACAAGATACAAACATACCTAGAT[G/T]AAGCAAATGCTGAGGTACAAAAACTAAATAAAGAGCTGGAAAGATATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 1375 2343 25 41
Genomic Location (Zv9):
Chromosome 19 (position 39093145)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37957128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAATAATTGAGAATCTTGAAAGCCTTCGAGAAGAGGCAACTAGAGAA[A/T]GAGCGACAGAAACAGCTCAAGCAACAAGGAGAGATTCTGAGGAATTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 1858 2343 33 41
Genomic Location (Zv9):
Chromosome 19 (position 39103453)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37967436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAACAGCAAAGAAATAGTTCAGAAATTAATGGTTGAAGTGGAGGAA[C/T]AGAGAAAAGACATTCGGCTCCAGAAAGAAGAACTTGACATTGAAAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 2066 2343 35 41
Genomic Location (Zv9):
Chromosome 19 (position 39104632)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37968615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGACCTTTTAGAACAAGAAAGAGAAGAAATAAATCATAAATGGAAA[C/T]AGTTACAACAGAGGATTGATGAATTTGATGCTCAAGTCAGCAAACAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 2085 2343 37 41
Genomic Location (Zv9):
Chromosome 19 (position 39105143)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37969126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAATTAATGGTTGAAGTGGAAAAACAGAAGCATGAGATTCAATTCC[A/T]GAAAGAAGAACTTGACATTGAAAGACAAAAAATTGCAGATGAACAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 2115 2343 37 41
Genomic Location (Zv9):
Chromosome 19 (position 39105235)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37969218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAGATCTTCTCATTCAAAATAAGATTGAACAGCAAAATGAAAATGAA[C/T]GAATCAAAGAAATGGATGAGGAAATAAAGAAAGAGAGAGAAACACTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 2195 2343 37 41
Genomic Location (Zv9):
Chromosome 19 (position 39105475)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37969458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAAAACAAGAACGAGAAGAAATGAATCATAAATTGACACAGTTACAA[C/T]AGAGGATTGATGAATTTGAGACTACAAGTAACATTCTTGTGACAACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 2235 2343 37 41
Genomic Location (Zv9):
Chromosome 19 (position 39105595)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37969578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGAAAAACTTCAACAGGCTATTAAGGAATATGAAAGCATCATAGAA[G/T]AAACAAACAGGAAAAGAACTGAGCTAGAAGAAATTGAGGTTGATCAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 2258 2343 39 41
Genomic Location (Zv9):
Chromosome 19 (position 39106241)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37970224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATGATAGGACTCCTAAAGAAGGAAATGGAGCAAACAAAATTCAATC[T/A]GGATGCTCAAGAGGAGGAACTGAAACTGGAAAAGCAAAAAATACAAAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link