ENSDARG00000044212

Ensembl ID:
ENSDARG00000044212
Human Orthologues:
CCDC88A, CCDC88C
Human Descriptions:
coiled-coil domain containing 88A [Source:HGNC Symbol;Acc:25523]
coiled-coil domain containing 88C [Source:HGNC Symbol;Acc:19967]
Mouse Orthologues:
Ccdc88a, Ccdc88c
Mouse Descriptions:
coiled coil domain containing 88A Gene [Source:MGI Symbol;Acc:MGI:1925177]
coiled-coil domain containing 88C Gene [Source:MGI Symbol;Acc:MGI:1915589]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6565 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23573 Nonsense Available for shipment Available now
sa23574 Nonsense Mutation detected in F1 DNA During 2014
sa23575 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Essential Splice Site 86 2343 3 41
Genomic Location:
Chromosome 19 (position 39081478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAAGAAAAGACATAGAGAAGATGAAAAAGAACATCWCAAGAGAAATG[C/G]ATGARATCAAACATCAAGARGAACAAATKAAACAAAAACAAGATGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 1375 2343 25 41
Genomic Location:
Chromosome 19 (position 39093145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAATAATTGAGAATCTTGAAAGCCTTCGAGAAGAGGCAACTAGAGAA[A/T]GAGCGACAGAAACAGCTCAAGCAACAAGGAGAGATTCTGAGGAATTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 1858 2343 33 41
Genomic Location:
Chromosome 19 (position 39103453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAACAGCAAAGAAATAGTTCAGAAATTAATGGTTGAAGTGGAGGAA[C/T]AGAGAAAAGACATTCGGCTCCAGAAAGAAGAACTTGACATTGAAAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077550 Nonsense 2066 2343 35 41
Genomic Location:
Chromosome 19 (position 39104632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGACCTTTTAGAACAAGAAAGAGAAGAAATAAATCATAAATGGAAA[C/T]AGTTACAACAGAGGATTGATGAATTTGATGCTCAAGTCAGCAAACAAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8065g9zy