prkab1a

Ensembl ID:
ENSDARG00000044183
ZFIN ID:
ZDB-GENE-040718-377
Description:
5'-AMP-activated protein kinase subunit beta-1 [Source:RefSeq peptide;Acc:NP_001002632]
Human Orthologue:
PRKAB1
Human Description:
protein kinase, AMP-activated, beta 1 non-catalytic subunit [Source:HGNC Symbol;Acc:9378]
Mouse Orthologue:
Prkab1
Mouse Description:
protein kinase, AMP-activated, beta 1 non-catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1336167]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa405 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064866 Nonsense 89 268 3 8
ENSDART00000146489 Nonsense 89 220 3 6
Genomic Location (Zv9):
Chromosome 10 (position 17970906)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17983252
KASP Assay ID:
554-0264.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGATCGACCCACTGTGTTTCGCTGGACAGGAGCTGGAAAGGAAGTGTA[T/A]ATTTCTGGGTCTTTCAATAATTGGACCAATAAGATTCCTCTGATTAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link