Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
prkab1a
- Ensembl ID:
- ENSDARG00000044183
- ZFIN ID:
- ZDB-GENE-040718-377
- Description:
- 5'-AMP-activated protein kinase subunit beta-1 [Source:RefSeq peptide;Acc:NP_001002632]
- Human Orthologue:
- PRKAB1
- Human Description:
- protein kinase, AMP-activated, beta 1 non-catalytic subunit [Source:HGNC Symbol;Acc:9378]
- Mouse Orthologue:
- Prkab1
- Mouse Description:
- protein kinase, AMP-activated, beta 1 non-catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1336167]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa405 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa405
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000064866 | Nonsense | 89 | 268 | 3 | 8 |
| ENSDART00000146489 | Nonsense | 89 | 220 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 10 (position 17970906)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 17983252 GRCz11 10 17940686 - KASP Assay ID:
- 554-0264.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAGATCGACCCACTGTGTTTCGCTGGACAGGAGCTGGAAAGGAAGTGTA[T/A]ATTTCTGGGTCTTTCAATAATTGGACCAATAAGATTCCTCTGATTAGAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
