GRID1 (2 of 2)

Ensembl ID:
ENSDARG00000044161
Description:
glutamate receptor, ionotropic, delta 1 [Source:HGNC Symbol;Acc:4575]
Human Orthologue:
GRID1
Human Description:
glutamate receptor, ionotropic, delta 1 [Source:HGNC Symbol;Acc:4575]
Mouse Orthologue:
Grid1
Mouse Description:
glutamate receptor, ionotropic, delta 1 Gene [Source:MGI Symbol;Acc:MGI:95812]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41979 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45454 Nonsense Mutation detected in F1 DNA During 2018
sa15073 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064839 Essential Splice Site 92 966 2 15
Genomic Location (Zv9):
Chromosome 12 (position 13710270)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12565923
GRCz11 12 12604226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGACATTCTCGAACAAAACCTTAATTGCTACCTTACTATGTCTTGC[A/G]GATATCCGCGGACTGCAGGTGTTTCTAGACCAGACATCAAGACAAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064839 Nonsense 540 966 9 15
Genomic Location (Zv9):
Chromosome 12 (position 13900974)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12756627
GRCz11 12 12794930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACTCGTTGCATAGTGCTATATGGATTGTCTACGGCGCCTTCGTACAA[C/T]AAGGTACTTCAATAAATTCTCCTCCGACAAGTCCATTCAAAGGCACCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064839 Nonsense 866 966 15 15
Genomic Location (Zv9):
Chromosome 12 (position 13938743)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12794396
GRCz11 12 12832699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYCTTATGGACGAGGACATGGCACACAAGCAGATCCCCGCACCATCTAT[C/T]GAGATCTCTGCCCTGGACATCGGCAGCATGCCGYCCAGCCAGCAGCGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link