GRID1 (2 of 2)

Ensembl ID:
ENSDARG00000044161
Description:
glutamate receptor, ionotropic, delta 1 [Source:HGNC Symbol;Acc:4575]
Human Orthologue:
GRID1
Human Description:
glutamate receptor, ionotropic, delta 1 [Source:HGNC Symbol;Acc:4575]
Mouse Orthologue:
Grid1
Mouse Description:
glutamate receptor, ionotropic, delta 1 Gene [Source:MGI Symbol;Acc:MGI:95812]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41979 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15073 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064839 Essential Splice Site 92 966 2 15
Genomic Location (Zv9):
Chromosome 12 (position 13710270)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12565923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTGACATTCTCGAACAAAACCTTAATTGCTACCTTACTATGTCTTGC[A/G]GATATCCGCGGACTGCAGGTGTTTCTAGACCAGACATCAAGACAAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064839 Nonsense 866 966 15 15
Genomic Location (Zv9):
Chromosome 12 (position 13938743)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 12794396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYCTTATGGACGAGGACATGGCACACAAGCAGATCCCCGCACCATCTAT[C/T]GAGATCTCTGCCCTGGACATCGGCAGCATGCCGYCCAGCCAGCAGCGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link