mafl

Ensembl ID:
ENSDARG00000044155
ZFIN ID:
ZDB-GENE-010605-3
Description:
Transcription factor MafA [Source:UniProtKB/Swiss-Prot;Acc:A3KMR8]
Human Orthologue:
MAFA
Human Description:
v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) [Source:HGNC Symbol;Acc:23145]
Mouse Orthologue:
Mafa
Mouse Description:
v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian) Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20729 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064833 Nonsense 117 315 1 1
Genomic Location:
Chromosome 6 (position 32399876)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCCTCGGGCAAACCGCAGATGGAAGATCTCTACTGGATTCCCAATTA[T/A]CAGCATCACATCAGTCCAGAGGCCCTCAACCTGACGCCCGAGGACGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ihyckjqs