ppp1cb

Ensembl ID:
ENSDARG00000044153
ZFIN ID:
ZDB-GENE-030616-609
Description:
serine/threonine-protein phosphatase PP1-beta catalytic subunit [Source:RefSeq peptide;Acc:NP_00100
Human Orthologue:
PPP1CB
Human Description:
protein phosphatase 1, catalytic subunit, beta isozyme [Source:HGNC Symbol;Acc:9282]
Mouse Orthologue:
Ppp1cb
Mouse Description:
protein phosphatase 1, catalytic subunit, beta isoform Gene [Source:MGI Symbol;Acc:MGI:104871]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18605 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130955 Nonsense 249 334 6 8
Genomic Location (Zv9):
Chromosome 17 (position 25479316)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25619235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTTTGGTGCTGATGTAGTCAGCAAATTCCTGAACCGCCAYGACCTGGACT[T/G]AATCTGTAGGGCACATCAGGTAACAGTTCATTTCAACCCATCTCATCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link