lrrc8db

Ensembl ID:
ENSDARG00000044146
ZFIN ID:
ZDB-GENE-061013-487
Description:
leucine-rich repeat-containing protein 8D [Source:RefSeq peptide;Acc:NP_001070848]
Human Orthologue:
LRRC8D
Human Description:
leucine rich repeat containing 8 family, member D [Source:HGNC Symbol;Acc:16992]
Mouse Orthologue:
Lrrc8d
Mouse Description:
leucine rich repeat containing 8D Gene [Source:MGI Symbol;Acc:MGI:1922368]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17213 Nonsense Available for shipment Available now
sa20687 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083327 Nonsense 121 841 2 2
Genomic Location (Zv9):
Chromosome 6 (position 21386440)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25074053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACTTCCCACAGTCRTCTGCTGTCAGGCAACCTCAGCCYACGGGTTTA[C/T]GAACAAATCTGGATTTTCAGCAGTATGTCTTTGTAAATCAGATGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083327 Nonsense 614 841 2 2
Genomic Location (Zv9):
Chromosome 6 (position 21384960)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25072573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACTTGTGGTTCACAACGATGGTACTAAACTCTTGGTGTTAAATAGCT[T/A]GAAAAAGATGATGAACCTTTCTGACCTGGAGCTGCACAATTGTGAACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link