lrrc8db

Ensembl ID:
ENSDARG00000044146
ZFIN ID:
ZDB-GENE-061013-487
Description:
leucine-rich repeat-containing protein 8D [Source:RefSeq peptide;Acc:NP_001070848]
Human Orthologue:
LRRC8D
Human Description:
leucine rich repeat containing 8 family, member D [Source:HGNC Symbol;Acc:16992]
Mouse Orthologue:
Lrrc8d
Mouse Description:
leucine rich repeat containing 8D Gene [Source:MGI Symbol;Acc:MGI:1922368]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17213 Nonsense Available for shipment Available now
sa30541 Nonsense Mutation detected in F1 DNA During 2015
sa5362 Nonsense Mutation detected in F1 DNA During 2015
sa5361 Nonsense Mutation detected in F1 DNA During 2015
sa20687 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa17213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083327 Nonsense 121 841 2 2
Genomic Location:
Chromosome 6 (position 21386440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACTTCCCACAGTCRTCTGCTGTCAGGCAACCTCAGCCYACGGGTTTA[C/T]GAACAAATCTGGATTTTCAGCAGTATGTCTTTGTAAATCAGATGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083327 Nonsense 147 841 2 2
Genomic Location:
Chromosome 6 (position 21386360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTAAATCAGATGTGCTACCATGTTGCCCTCCCATGGTATTCCAAGTA[C/A]TTTCCATATCTAGCTCTCATTCACACAATTGTTCTTATGGTAAGCAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083327 Nonsense 169 841 2 2
Genomic Location:
Chromosome 6 (position 21386294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATTCACACAATTGTTCTTATGGTAAGCAGTAACTTTTGGTTCAAGTA[T/A]CCAAAGACCAGTTCCAAAATTGAGCATTTTGTGTCTATTTTGGGTAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083327 Nonsense 512 841 2 2
Genomic Location:
Chromosome 6 (position 21385267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAAACCTCACCGAATTGCACTTTTACCACTGTCCCGCCAAAGTTGAA[C/T]AGACTGCATTCAGTTTCCTCCGCGATCACCTCCGGTGCCTTCACGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083327 Nonsense 614 841 2 2
Genomic Location:
Chromosome 6 (position 21384960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACTTGTGGTTCACAACGATGGTACTAAACTCTTGGTGTTAAATAGCT[T/A]GAAAAAGATGATGAACCTTTCTGACCTGGAGCTGCACAATTGTGAACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/maeszqwy