Q58EF5_DANRE

Ensembl ID:
ENSDARG00000044144
Description:
KIAA0261 protein [Source:UniProtKB/TrEMBL;Acc:Q58EF5]
Human Orthologue:
WAPAL
Human Description:
wings apart-like homolog (Drosophila) [Source:HGNC Symbol;Acc:23293]
Mouse Orthologue:
Wapal
Mouse Description:
wings apart-like homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2675859]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42941 Nonsense Mutation detected in F1 DNA During 2017
sa12782 Nonsense Available for shipment Available now
sa42942 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 Nonsense 3 1062 2 17
ENSDART00000122105 Nonsense 3 1153 1 19
Genomic Location (Zv9):
Chromosome 17 (position 25699994)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25839913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGTTTTACTTCTTTATAGATAATATGTAACAAGCGACAAAATGACAT[C/A]AAGATTTAGTAAAACGTACACGCGGAAGGGAGGAGAAGCCAGCTCAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 Nonsense 48 1062 2 17
ENSDART00000122105 Nonsense 48 1153 1 19
Genomic Location (Zv9):
Chromosome 17 (position 25700128)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25840047
KASP Assay ID:
2261-1111.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCACCAAATGGGGAGAGTCCACCTACAAGGCGCATTTGGGCATCAAA[C/T]GACCCTCATTCAAGCCAGATGTTTCAGAGCTGACCAAACGACCCCGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064817 Nonsense 760 1062 11 17
ENSDART00000122105 Nonsense 760 1153 10 19
Genomic Location (Zv9):
Chromosome 17 (position 25714717)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25854636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCATTTAGCAATGGAAACGCTGCTGTCTCTGACGTCGAAGCGAGCT[G/T]GAGACTGGTTTAAGGAGGAGCTGCGTTTACTTGGGGGACTGGACCACATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link