si:ch211-103f16.2

Ensembl ID:
ENSDARG00000044143
ZFIN ID:
ZDB-GENE-050208-491
Description:
nucleolar protein 8 [Source:RefSeq peptide;Acc:NP_001073671]
Human Orthologue:
NOL8
Human Description:
nucleolar protein 8 [Source:HGNC Symbol;Acc:23387]
Mouse Orthologue:
Nol8
Mouse Description:
nucleolar protein 8 Gene [Source:MGI Symbol;Acc:MGI:1918180]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16087 Nonsense Available for shipment Available now
sa18266 Nonsense Available for shipment Available now
sa43776 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064809 Nonsense 243 1230 6 16
ENSDART00000111962 Nonsense 243 1176 7 16
Genomic Location (Zv9):
Chromosome 22 (position 10546462)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10406630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGCAATGGAATTAATGCGCCTGCATCTGSAAACAARAACAAAATCCWG[C/T]AACGTGACCTTCCTGCTACCAAAACAGAACAACCAGTTGTTAAAAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064809 Nonsense 532 1230 6 16
ENSDART00000111962 Nonsense 532 1176 7 16
Genomic Location (Zv9):
Chromosome 22 (position 10545594)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10405762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATAAAAGTCAACCGCATTCTTCAAACCAACCWTCGCARCAGAAATTGT[C/A]AACTTTACAAGTCAAATCAGCCTCAATRAAAYTTGAAAATGAAKGGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064809 Nonsense 679 1230 6 16
ENSDART00000111962 Nonsense 679 1176 7 16
Genomic Location (Zv9):
Chromosome 22 (position 10545153)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10405321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGTGTGGAAGACATCATCACTTCCAAAATGTCTTCAGCCACACACT[T/A]GGTAAAAACAATCCCCAAAACCACAATAAACACAGCAAATACATCAGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link