rab3gap2

Ensembl ID:
ENSDARG00000044136
ZFIN IDs:
ZDB-GENE-030616-610, ZDB-GENE-030616-610
Description:
rab3 GTPase-activating protein non-catalytic subunit [Source:RefSeq peptide;Acc:NP_001004528]
Human Orthologue:
RAB3GAP2
Human Description:
RAB3 GTPase activating protein subunit 2 (non-catalytic) [Source:HGNC Symbol;Acc:17168]
Mouse Orthologue:
Rab3gap2
Mouse Description:
RAB3 GTPase activating protein subunit 2 Gene [Source:MGI Symbol;Acc:MGI:1916043]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9042 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa18323 Nonsense Available for shipment Available now
sa17477 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064806 Nonsense 178 1373 7 37
ENSDART00000105503 Splice Site None 1270 None 35
ENSDART00000126201 Nonsense 178 1143 7 37
Genomic Location:
Chromosome 17 (position 25469672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATTTTTTNNATCTATGTGTATGTGTAGAGTGGAGTTCTTCTATTAGCA[C/T]AGTTGTTGCATGAAGATCCTGTGCTGCGCCTGAAATGTCGGACTTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064806 Nonsense 1004 1373 28 37
ENSDART00000105503 Nonsense 942 1270 25 35
ENSDART00000126201 Nonsense 975 1143 26 37
Genomic Location:
Chromosome 17 (position 25459427)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNNNNNNNNNNNNNNNNNAATCTMCTGATGTGCTKTTTGCTCACTG[T/A]AGCTGGGAAAATGTGGTGCAGTGGAACAAAGACCCAGAGGTAAAAACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064806 Essential Splice Site 1324 1373 None 37
ENSDART00000105503 Essential Splice Site 1220 1270 None 35
ENSDART00000126201 Essential Splice Site None 1143 None 37
Genomic Location:
Chromosome 17 (position 25452954)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTGGCTCGTCTGCCACCCACCCTCTGCACGTGGCTGAAGGCTATGG[T/A]GAGAACACGCACACACTGCACACYTCTCAAMAGATCACATCATTTGCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e04fxqeq