iars2

Ensembl ID:
ENSDARG00000044134
ZFIN ID:
ZDB-GENE-030616-608
Description:
isoleucyl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_001157270]
Human Orthologue:
IARS2
Human Description:
isoleucyl-tRNA synthetase 2, mitochondrial [Source:HGNC Symbol;Acc:29685]
Mouse Orthologue:
Iars2
Mouse Description:
isoleucine-tRNA synthetase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1919586]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14246 Nonsense Available for shipment Available now
sa2910 Essential Splice Site Available for shipment Available now
sa17843 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Nonsense 181 983 4 23
ENSDART00000138853 Nonsense 181 886 4 21
Genomic Location:
Chromosome 17 (position 25434762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGCTGCTTTCCAGCGCTGGGGTGTGATGGCTGACTGGGACAACTGTTA[T/G]TACACTTTTGATGGGAAATATGAAGCAGCCCAGCTCAAGGTCTTCCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Essential Splice Site 381 983 9 23
ENSDART00000138853 Essential Splice Site 381 886 9 21
Genomic Location:
Chromosome 17 (position 25436412)
KASP Assay ID:
554-2884.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATGGCATGGATGACTACAGTGTCGCCACACACTTCAATCTACCAGTA[G/T]TATGTGACCCATACCTGTATATAACAACTAGGGATGCCAGATCGATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064803 Nonsense 524 983 13 23
ENSDART00000138853 Nonsense 524 886 13 21
Genomic Location:
Chromosome 17 (position 25438738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCAAAACAARTCCCTGTTTCWCTYAGACATACAGTGACCCACATCGCT[A/T]AAGTTTTCTCTGAGAAGGGGAGCGACAGCTGGTGGACAGAGCCAGTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vdfgugb6