egr2a

Ensembl ID:
ENSDARG00000044098
ZFIN ID:
ZDB-GENE-030723-6
Description:
early growth response 2a [Source:RefSeq peptide;Acc:NP_899184]
Human Orthologue:
EGR2
Human Description:
early growth response 2 [Source:HGNC Symbol;Acc:3239]
Mouse Orthologue:
Egr2
Mouse Description:
early growth response 2 Gene [Source:MGI Symbol;Acc:MGI:95296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32172 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064749 Nonsense 261 372 2 2
ENSDART00000077990 Nonsense 282 393 2 2
ENSDART00000127945 Nonsense 137 248 1 1
ENSDART00000137015 Nonsense 137 248 2 2
Genomic Location (Zv9):
Chromosome 17 (position 43708875)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 13039975
GRCz10 17 43673550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGAATGTCCCACTCAGGCCAATACTGCGGCCACGGAAATACCCGAAC[C/T]GACCGTGCAAGACGCCGGTGCACGAGCGCCCGTATCCGTGTCCGGCCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)
  • Temperament: A genome-wide meta-analysis of association studies of Cloninger's Temperament Scales. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link