LOC571581

Ensembl ID:
ENSDARG00000044096
Human Orthologue:
NRBF2
Human Description:
nuclear receptor binding factor 2 [Source:HGNC Symbol;Acc:19692]
Mouse Orthologue:
Nrbf2
Mouse Description:
nuclear receptor binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1354950]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7839 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064748 Essential Splice Site 52 143 3 4
Genomic Location:
Chromosome 17 (position 43738370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCAGAGCTGTTGAAAGAAGCTTCATCAATGACACAGAGTMAACAGG[T/C]AAGACGTGTTTGAGACAGCAAGTGTGTCTCCATTGCAGTAGGGCGCMGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5t9yuav9