gfpt2

Ensembl ID:
ENSDARG00000044094
ZFIN ID:
ZDB-GENE-071113-1
Description:
glucosamine--fructose-6-phosphate aminotransferase [Source:RefSeq peptide;Acc:NP_001029093]
Human Orthologue:
GFPT2
Human Description:
glutamine-fructose-6-phosphate transaminase 2 [Source:HGNC Symbol;Acc:4242]
Mouse Orthologue:
Gfpt2
Mouse Description:
glutamine fructose-6-phosphate transaminase 2 Gene [Source:MGI Symbol;Acc:MGI:1338883]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23985 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076974 Essential Splice Site 319 681 10 19
Genomic Location (Zv9):
Chromosome 21 (position 31174033)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32373503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCGTGTCATTCAAACCCTTCAGATGGAGCTCCAGCAGATCATGAAAGG[T/G]CCCGCATCACACTGACACCACCCAAATGTTATTTCACTGAATTACTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link