rpl13a

Ensembl ID:
ENSDARG00000044093
ZFIN ID:
ZDB-GENE-030131-168
Description:
60S ribosomal protein L13a [Source:RefSeq peptide;Acc:NP_997949]
Human Orthologue:
RPL13A
Human Description:
ribosomal protein L13a [Source:HGNC Symbol;Acc:10304]
Mouse Orthologues:
Rpl13a, Rpl13a-ps1
Mouse Descriptions:
ribosomal protein 13A, pseudogene 1 Pseudogene [Source:MGI Symbol;Acc:MGI:3648883]
ribosomal protein L13A Gene [Source:MGI Symbol;Acc:MGI:1351455]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32152 Nonsense Available for shipment Available now
sa6477 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064739 Nonsense 142 205 7 7
ENSDART00000128758 Nonsense 142 205 7 8

The following transcripts of ENSDARG00000044093 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 24445840)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24599282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTATAAATTGTATTTTTCCTGTCTTTCACTAGTTTGCCCTGCTTGGA[C/T]GATTGGCCCATGAAGTTGGCTGGAAGTACCAGGCCATCACCGCCACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064739   None 205 None 7
ENSDART00000128758 Essential Splice Site None 205 None 8

The following transcripts of ENSDARG00000044093 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 24446891)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24600333
KASP Assay ID:
554-5028.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTTCATGACACAAGATCAGTTCACTGCTTTGCAACTGCTGTTAAAGG[T/C]AGTGTAATATCACATACTGTTTAGTATATYGCTGAATTACTTGGCTTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link