LOC100333060

Ensembl ID:
ENSDARG00000044091
Human Orthologues:
PITPNA, PITPNM3
Human Descriptions:
phosphatidylinositol transfer protein, alpha [Source:HGNC Symbol;Acc:9001]
PITPNM family member 3 [Source:HGNC Symbol;Acc:21043]
Mouse Orthologue:
Pitpna
Mouse Description:
phosphatidylinositol transfer protein, alpha Gene [Source:MGI Symbol;Acc:MGI:99887]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41657 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002974 Nonsense 212 273 8 10
Genomic Location (Zv9):
Chromosome 10 (position 24765385)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24364737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAACTGGTTACTGTCAAGTTCAAGTGGTGGGGCCTGCAAAACAAAGTG[G/T]AAAACTTTATTCAAAAGGTCAGTGTGATTTACTGAAGAACTAATTACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link