TGM1 (5 of 6)

Ensembl ID:
ENSDARG00000044084
Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Human Orthologue:
TGM1
Human Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Mouse Orthologue:
Tgm1
Mouse Description:
transglutaminase 1, K polypeptide Gene [Source:MGI Symbol;Acc:MGI:98730]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24400 Nonsense Mutation detected in F1 DNA During 2014
sa24399 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064720 Nonsense 341 772 6 13
Genomic Location:
Chromosome 23 (position 40474317)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTGCCCGCATGTTTCTATGTGTTGGAGAAGAGCGGTACCCCTTGCT[C/A]AGGATGGGGAAACCCCATTAACATCTCCAGAGTGGTGTCTGAGATGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064720 Nonsense 643 772 11 13
Genomic Location:
Chromosome 23 (position 40469970)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCAATCTAAAAAACAAATGCAACCAGCCTCGTAGCATCACCCTCTA[C/A]AGCCATGCTGCAGCCATGTACTACACCGGAGTCAGGAGGACCTACCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s58vclvt