nkx6.2

Ensembl ID:
ENSDARG00000044075
ZFIN IDs:
ZDB-GENE-070626-1, ZDB-GENE-070626-1
Description:
homeobox protein Nkx-6.2 [Source:RefSeq peptide;Acc:NP_001129256]
Human Orthologue:
NKX6-2
Human Description:
NK6 homeobox 2 [Source:HGNC Symbol;Acc:19321]
Mouse Orthologue:
Nkx6-2
Mouse Description:
NK6 homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1352738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa660 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa660
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127624 Nonsense 186 278 2 3
ENSDART00000130200 Nonsense 159 167 3 3
Genomic Location (Zv9):
Chromosome 13 (position 52989230)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 51155980
KASP Assay ID:
554-0568.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGAGCAGACCAAATATCTGGCCGGTCCGGAGAGAGCCAGACTCGCCTA[T/A]TCTCTGGGAATGACCGAGAGCCAAGTCAAGGTAAACACAAAACTCCCAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link