loxl2b

Ensembl ID:
ENSDARG00000044074
ZFIN ID:
ZDB-GENE-050208-29
Description:
lysyl oxidase homolog 2 [Source:RefSeq peptide;Acc:NP_001074095]
Human Orthologue:
LOXL2
Human Description:
lysyl oxidase-like 2 [Source:HGNC Symbol;Acc:6666]
Mouse Orthologue:
Loxl2
Mouse Description:
lysyl oxidase-like 2 Gene [Source:MGI Symbol;Acc:MGI:2137913]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14825 Nonsense Mutation detected in F1 DNA During 2014
sa20426 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064701 Nonsense 153 762 3 14
ENSDART00000144013 Nonsense 153 762 3 14
Genomic Location:
Chromosome 5 (position 29088870)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATTGGTGTGTCTGATTGCAAACATTCTGAGGATGTCGGGGTCGTTTG[C/A]AGTGACAAGAGAATCCCAGGATTCAAGTTYGTCAACACCCTTACCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064701 Nonsense 551 762 10 14
ENSDART00000144013 Nonsense 551 762 10 14
Genomic Location:
Chromosome 5 (position 29125435)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTTTCTAGCTGCTCCAGATCTGGTGCTCAACCCGCAGGTGGTGGAA[C/T]AGACCACATATTTGGAGGACCGTCCTATGTTCATGTTACAGTGTGCTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3f00ut03