fuca2

Ensembl ID:
ENSDARG00000044073
ZFIN ID:
ZDB-GENE-040822-39
Description:
plasma alpha-L-fucosidase [Source:RefSeq peptide;Acc:NP_001004115]
Human Orthologue:
FUCA2
Human Description:
fucosidase, alpha-L- 2, plasma [Source:HGNC Symbol;Acc:4008]
Mouse Orthologue:
Fuca2
Mouse Description:
fucosidase, alpha-L- 2, plasma Gene [Source:MGI Symbol;Acc:MGI:1914098]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42861 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064700 Nonsense 21 453 1 7
Genomic Location (Zv9):
Chromosome 17 (position 6215444)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6294380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTTTGTCCGTTTGTTTACTCCTGATCGGTTGCTGTGTTTGTCAATA[T/A]CAGCCTACGTGGGAATCAATTGATTCAAGACCTGTACCGGAATGGTTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link