ctbp2

Ensembl ID:
ENSDARG00000044062
ZFIN IDs:
ZDB-GENE-010130-2, ZDB-GENE-010130-2, ZDB-GENE-010130-2
Description:
C-terminal-binding protein 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001182420]
Human Orthologues:
AC011841.1, CTBP2
Human Descriptions:
C-terminal binding protein 2 pseudogene (MGC70870), non-coding RNA [Source:RefSeq DNA;Acc:NR_003682]
C-terminal binding protein 2 [Source:HGNC Symbol;Acc:2495]
Mouse Orthologue:
Ctbp2
Mouse Description:
C-terminal binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1201686]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10746 Nonsense Available for shipment Available now
sa297 Nonsense F2 line generated During 2014
sa17809 Nonsense Available for shipment Available now
sa23003 Nonsense Mutation detected in F1 DNA During 2014
sa12314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 285 710 1 9
ENSDART00000017337 Nonsense 285 1148 1 11
ENSDART00000049236 None None 405 None 11
Genomic Location:
Chromosome 17 (position 8517904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACATGCCTGGTGGTTGAWCCAGTTGCTCAAGGAATGGATGGAACTTCC[C/T]GAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa297
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 310 1148 1 11
ENSDART00000049236 None None 405 None 11
Genomic Location:
Chromosome 17 (position 8517829)
KASP Assay ID:
554-3044.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAA[C/T]AAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 593 1148 2 11
ENSDART00000049236 None None 405 None 11
Genomic Location:
Chromosome 17 (position 8516951)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGACCCAGCAGTGCWCCCTCCCAGCAGCTTCTTGAGACCAGTKGGTA[T/A]SCTGGACCYAGGGTTTCCGGGGTATACAGTRGTGCTATGGTTCCTGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 475 710 5 9
ENSDART00000017337 Nonsense 952 1148 6 11
ENSDART00000049236 Nonsense 209 405 6 11
Genomic Location:
Chromosome 17 (position 8466467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCAGTGGCAGTTCGAGCGAAAGCGTTTGGCTTTAATGTGATCTTTTA[C/A]GACCCGTATCTGCAAGACGGATTAGAGCGATCGCTGGGCGTGCAGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 None None 710 None 9
ENSDART00000017337 Nonsense 1147 1148 10 11
ENSDART00000049236 Nonsense 404 405 10 11
Genomic Location:
Chromosome 17 (position 8449614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAGCCGCTCCCAGCCGTCTCTCCCGGCGGCCTGCAAGACAAAATGTA[T/A]ACCTAAACAATGACAGGTAAATAKTGCTNAAAGTCCCCGAAGAGAWCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rm4ocxds