ctbp2

Ensembl ID:
ENSDARG00000044062
ZFIN IDs:
ZDB-GENE-010130-2, ZDB-GENE-010130-2, ZDB-GENE-010130-2
Description:
C-terminal-binding protein 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001182420]
Human Orthologues:
AC011841.1, CTBP2
Human Descriptions:
C-terminal binding protein 2 pseudogene (MGC70870), non-coding RNA [Source:RefSeq DNA;Acc:NR_003682]
C-terminal binding protein 2 [Source:HGNC Symbol;Acc:2495]
Mouse Orthologue:
Ctbp2
Mouse Description:
C-terminal binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1201686]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42871 Nonsense Mutation detected in F1 DNA During 2016
sa42870 Nonsense Mutation detected in F1 DNA During 2016
sa10746 Nonsense Available for shipment Available now
sa30695 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016
sa297 Nonsense F2 line generated During 2016
sa32124 Nonsense Available for shipment Available now
sa32123 Nonsense Available for shipment Available now
sa17809 Nonsense Available for shipment Available now
sa23003 Nonsense Available for shipment Available now
sa32122 Nonsense Available for shipment Available now
sa12314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 42 710 1 9
ENSDART00000017337 Nonsense 42 1148 1 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8518633)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGGAGCGCAGTGACAGTGTTTACGAGCAGCAGGCCCGGATGGCTGGT[C/T]GACGCAACTCGCTGAGCTACGGAGCGGATGCAGGAGGGGGATGGTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 139 710 1 9
ENSDART00000017337 Nonsense 139 1148 1 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8518340)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATCAGCAAGACCCAGGCATGCCATCCCGGCCAACAGAGGGTTTCTA[T/A]CGTGGCGAACAGCCTCATTCTCTGAATAGGTCATCTTCACATTATGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 285 710 1 9
ENSDART00000017337 Nonsense 285 1148 1 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517904)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACATGCCTGGTGGTTGAWCCAGTTGCTCAAGGAATGGATGGAACTTCC[C/T]GAGGTATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Essential Splice Site 285 710 1 9
ENSDART00000017337 Missense 286 1148 1 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517900)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCTGGTGGTTGATCCAGTTGCTCAAGGAATGGATGGAACTTCCCGAG[G/A]TATGGTCATGCATCCGGAAAACCCCTCACCATACACCATACAGCAGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa297
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546   None 710 None 9
ENSDART00000017337 Nonsense 310 1148 1 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517829)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515171
KASP Assay ID:
554-3044.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCTCACCATACACCATACAGCAGCAACAGCAAGCCCAACAGCAGCAA[C/T]AAATGCAACAGCAAATACAACAGCAACAAATGCAGCAGGTTCAGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546   None 710 None 9
ENSDART00000017337 Nonsense 328 1148 2 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517748)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAA[C/T]AAATGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546   None 710 None 9
ENSDART00000017337 Nonsense 337 1148 2 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8517721)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8515063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCAGGTTCAGCCAGTGCAACAAATGCAGCAGGTTCAGCCAGTGCAA[C/T]AAATGCAGCAAGCTCAGCCAGTGCAACAAATGCAGCAAGCTCAGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546   None 710 None 9
ENSDART00000017337 Nonsense 593 1148 2 11
ENSDART00000049236   None 405 None 11
Genomic Location (Zv9):
Chromosome 17 (position 8516951)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8514293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGACCCAGCAGTGCWCCCTCCCAGCAGCTTCTTGAGACCAGTKGGTA[T/A]SCTGGACCYAGGGTTTCCGGGGTATACAGTRGTGCTATGGTTCCTGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 475 710 5 9
ENSDART00000017337 Nonsense 952 1148 6 11
ENSDART00000049236 Nonsense 209 405 6 11
Genomic Location (Zv9):
Chromosome 17 (position 8466467)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8463809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCAGTGGCAGTTCGAGCGAAAGCGTTTGGCTTTAATGTGATCTTTTA[C/A]GACCCGTATCTGCAAGACGGATTAGAGCGATCGCTGGGCGTGCAGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546 Nonsense 609 710 7 9
ENSDART00000017337 Nonsense 1086 1148 8 11
ENSDART00000049236 Nonsense 343 405 8 11
Genomic Location (Zv9):
Chromosome 17 (position 8457048)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8454390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGCAGGCCTCACTAGAGATGAGAGAGGCAGCAGCCACCGAGATCCGC[A/T]GAGCCATCACCGGTACAACATCTCACTGCATTTATTACACACTGCTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012546   None 710 None 9
ENSDART00000017337 Nonsense 1147 1148 10 11
ENSDART00000049236 Nonsense 404 405 10 11
Genomic Location (Zv9):
Chromosome 17 (position 8449614)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8446956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAGCCGCTCCCAGCCGTCTCTCCCGGCGGCCTGCAAGACAAAATGTA[T/A]ACCTAAACAATGACAGGTAAATAKTGCTNAAAGTCCCCGAAGAGAWCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link