ahi1

Ensembl ID:
ENSDARG00000044056
ZFIN IDs:
ZDB-GENE-060803-1, ZDB-GENE-060803-1
Description:
jouberin [Source:RefSeq peptide;Acc:NP_001071029]
Human Orthologue:
AHI1
Human Description:
Abelson helper integration site 1 [Source:HGNC Symbol;Acc:21575]
Mouse Orthologue:
Ahi1
Mouse Description:
Abelson helper integration site 1 Gene [Source:MGI Symbol;Acc:MGI:87971]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15936 Nonsense Available for shipment Available now
sa36321 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36320 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32121 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064668   17 936 1 21
ENSDART00000130253 Nonsense 172 1190 3 26
Genomic Location:
Chromosome 17 (position 8101681)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACTCGAGTCAACAGAAAGAGCAGACGGAGACAGAAGATGATTATTTA[C/T]GAGCGTACCAACATCAGATCTCACAGGAAGAAGAGACGGCGGGAAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064668 Essential Splice Site 693 936 14 21
ENSDART00000130253 Essential Splice Site 922 1190 17 26
Genomic Location:
Chromosome 17 (position 8081127)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGTCCCTGAAGATGCAGCGGGTCAAACAGAAACTAGACTCTGTGCTG[G/A]TAAAAATGGTGATTTATAGAAAATGAAGCAAAATATAATTCAGTCAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064668 Essential Splice Site 694 936 15 21
ENSDART00000130253 Essential Splice Site 948 1190 20 26
Genomic Location:
Chromosome 17 (position 8078501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCTGCTCTGTAATACTAAACTGAGCTCTTGTTATTGTTTTTTTTTTC[A/G]GGGCCTGAACTCATATCTTCCTCCTCCATCTCTACTGTCTCCTCACTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064668 Nonsense 910 936 21 21
ENSDART00000130253 Nonsense 1164 1190 26 26
Genomic Location:
Chromosome 17 (position 8070267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGATTGAAGTTCCCTCTGAAGATCTGCCTCCATCTTCAGGATCTTCC[A/T]GAAGAAGGAGACCTCTTCCCAAACTCGGCCAAGCCAACGGTGCGTTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link