rassf2l

Ensembl ID:
ENSDARG00000044044
ZFIN ID:
ZDB-GENE-041221-6
Description:
Ras association (RalGDS/AF-6) domain family 2, like [Source:RefSeq peptide;Acc:NP_001002195]
Human Orthologue:
RASSF2
Human Description:
Ras association (RalGDS/AF-6) domain family member 2 [Source:HGNC Symbol;Acc:9883]
Mouse Orthologue:
Rassf2
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 2 Gene [Source:MGI Symbol;Acc:MGI:2442060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8593 Nonsense Mutation detected in F1 DNA During 2014
sa10991 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Nonsense 41 316 3 10
ENSDART00000142028 Nonsense 41 312 3 10
Genomic Location:
Chromosome 10 (position 20726307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATCTCAAAACATATAACGTGTATTTTGAAGGAGATGCCCTTCAGTTG[A/T]GWCACAGAGAGRTTGGTTATTTGGCAAGCTAYAGTCTRTTGTTTTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Essential Splice Site 44 316 3 10
ENSDART00000142028 Essential Splice Site 44 312 3 10
Genomic Location:
Chromosome 10 (position 20726295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATAACGTGTATTTTGAAGGAGATGCCCTTCAGTTGWGWCACAGAGAG[G/A]TTGGTTATTTGGCAAGCTAYAGTCTRTTGTTTTGATGTGTTACACCACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u67ifu12