rassf2l

Ensembl ID:
ENSDARG00000044044
ZFIN ID:
ZDB-GENE-041221-6
Description:
Ras association (RalGDS/AF-6) domain family 2, like [Source:RefSeq peptide;Acc:NP_001002195]
Human Orthologue:
RASSF2
Human Description:
Ras association (RalGDS/AF-6) domain family member 2 [Source:HGNC Symbol;Acc:9883]
Mouse Orthologue:
Rassf2
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 2 Gene [Source:MGI Symbol;Acc:MGI:2442060]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8593 Nonsense Mutation detected in F1 DNA During 2016
sa10991 Essential Splice Site Available for shipment Available now
sa34887 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Nonsense 41 316 3 10
ENSDART00000142028 Nonsense 41 312 3 10
Genomic Location (Zv9):
Chromosome 10 (position 20726307)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20687721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACATCTCAAAACATATAACGTGTATTTTGAAGGAGATGCCCTTCAGTTG[A/T]GWCACAGAGAGRTTGGTTATTTGGCAAGCTAYAGTCTRTTGTTTTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Essential Splice Site 44 316 3 10
ENSDART00000142028 Essential Splice Site 44 312 3 10
Genomic Location (Zv9):
Chromosome 10 (position 20726295)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20687709
KASP Assay ID:
2260-3149.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATAACGTGTATTTTGAAGGAGATGCCCTTCAGTTGWGWCACAGAGAG[G/A]TTGGTTATTTGGCAAGCTAYAGTCTRTTGTTTTGATGTGTTACACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064662 Essential Splice Site 223 316 8 10
ENSDART00000142028 Essential Splice Site 219 312 8 10
Genomic Location (Zv9):
Chromosome 10 (position 20724183)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20685597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTTTCTTTTGTTTGTGCAAGATAGTTCATTTTCATTTTGTCATTTA[G/A]AGAGGCATCAGCTGAAGCCCAATGATCATCCTTTGCTGGTTAGAGTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link