myo6a

Ensembl ID:
ENSDARG00000044016
ZFIN ID:
ZDB-GENE-040819-2
Description:
myosin VIa [Source:RefSeq peptide;Acc:NP_001004111]
Human Orthologue:
MYO6
Human Description:
myosin VI [Source:HGNC Symbol;Acc:7605]
Mouse Orthologue:
Myo6
Mouse Description:
myosin VI Gene [Source:MGI Symbol;Acc:MGI:104785]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23617 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3048 Essential Splice Site Available for shipment Available now
sa16041 Nonsense Available for shipment Available now
sa6610 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015558 Essential Splice Site 516 1253 14 31
ENSDART00000064620 Essential Splice Site 516 1292 14 35
ENSDART00000135066 Essential Splice Site 516 1288 14 34
ENSDART00000136768 Essential Splice Site 516 1253 15 32
Genomic Location:
Chromosome 20 (position 778943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGGGAGTCAATGAAGTGCACTACGTTGATAATCAGGACTGTATAGG[T/G]CTGTATCTCAGATAAAACTCTGACTTGATTGAGCTGTTGAAATGATATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015558 Essential Splice Site 761 1253 21 31
ENSDART00000064620 Essential Splice Site 761 1292 21 35
ENSDART00000135066 Essential Splice Site 761 1288 21 34
ENSDART00000136768 Essential Splice Site 761 1253 22 32
Genomic Location:
Chromosome 20 (position 782077)
KASP Assay ID:
554-2521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACGATTATAAATTTGGCTTGACAAAAGTGTTCTTCAGACCTGGAAAGG[T/A]AATGTGACTCGAGTTTTAYGGTTGTTTTTAATTTNNNNNNNNNNGTGGTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015558 Nonsense 1135 1253 30 31
ENSDART00000064620 Nonsense 1170 1292 33 35
ENSDART00000135066 Nonsense 1170 1288 33 34
ENSDART00000136768 Nonsense 1135 1253 31 32
Genomic Location:
Chromosome 20 (position 798761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTGGTGCCRGCTGCAGTGCCCCGYCAGCATGAGATCGTCATGAACCGA[C/T]AGCAGCGCTTCTTCCGCATCCCCTTCATCCGGCCYGGAGACCAGTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015558 Nonsense 1243 1253 31 31
ENSDART00000064620 Nonsense 1278 1292 34 35
ENSDART00000135066 Nonsense 1278 1288 34 34
ENSDART00000136768 Nonsense 1243 1253 32 32
Genomic Location:
Chromosome 20 (position 799357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGTACCTGAGGAACGCCATCGAGAGCAGACAGGCCAGACCCACATA[C/A]GCCACCGCCATGCTGCAGAGCATGCTCAAATAAACACACACACACACACNNNNNNNNNNT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ve7rkfg0