si:ch211-274l13.1

Ensembl ID:
ENSDARG00000044015
ZFIN ID:
ZDB-GENE-091204-26
Human Orthologues:
AC144571.1, GFRA2
Human Description:
GDNF family receptor alpha 2 [Source:HGNC Symbol;Acc:4244]
Mouse Orthologue:
Gfra2
Mouse Description:
glial cell line derived neurotrophic factor family receptor alpha 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21711 Essential Splice Site Available for shipment Available now
sa15984 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080430 Essential Splice Site 123 488 3 9
ENSDART00000148013   None 119 None 2
Genomic Location (Zv9):
Chromosome 10 (position 19792114)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19801542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACAATAATAATAGCTCTTTTATTTCCTCTGTGTTCTGTTCTTTTCA[A/G]GGTGAAGAACTCTATGAGACCTCTCCATATGAACCGATGCATCTTTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080430 Nonsense 399 488 7 9
ENSDART00000148013   None 119 None 2
Genomic Location (Zv9):
Chromosome 10 (position 19755069)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19764564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCGGCAGTCCCATCAGTACGGAMCAATCTGCAACCGGCTATCATCACC[A/T]AACATGTCATCAACTCAAATGATGTCAAGCAAATAGACAGTGCATGYGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link