loxl2a

Ensembl ID:
ENSDARG00000044010
ZFIN ID:
ZDB-GENE-070818-1
Description:
lysyl oxidase-like 2a [Source:RefSeq peptide;Acc:NP_001092714]
Human Orthologue:
LOXL2
Human Description:
lysyl oxidase-like 2 [Source:HGNC Symbol;Acc:6666]
Mouse Orthologue:
Loxl2
Mouse Description:
lysyl oxidase-like 2 Gene [Source:MGI Symbol;Acc:MGI:2137913]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34884 Nonsense Mutation detected in F1 DNA During 2016
sa2575 Nonsense Mutation detected in F1 DNA During 2016
sa14076 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064613 Nonsense 87 737 1 13
Genomic Location:
Chromosome 10 (position 20526496)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTGGCTTCTTGGGCGCTGTCGCTTGGTCTCCGTCTGCAAAGTTTGGA[C/T]AAGGAGAAGGTAGGCCAAAAGCTTATTGAAGATCCACTATGTACATATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064613 Nonsense 133 737 2 13
Genomic Location:
Chromosome 10 (position 20525073)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCGGACTGCAGGCACAGTGAGGATGTCGGGGTGATTTGCAATCAAAAG[C/T]GAATTCCTGGTCACAGGTTCATCAATATCATGAACAACAATRTTGAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064613 Nonsense 685 737 12 13
Genomic Location:
Chromosome 10 (position 20490687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCNCCTGACACGTCTCTTTCTGRCACACAGGTGGTAATCAATCCAAACTA[T/A]GACGTCGCTGAATCAGATTACACCAACAACGTCATGAAGTGCAAGTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link