loxl2a

Ensembl ID:
ENSDARG00000044010
ZFIN ID:
ZDB-GENE-070818-1
Description:
lysyl oxidase-like 2a [Source:RefSeq peptide;Acc:NP_001092714]
Human Orthologue:
LOXL2
Human Description:
lysyl oxidase-like 2 [Source:HGNC Symbol;Acc:6666]
Mouse Orthologue:
Loxl2
Mouse Description:
lysyl oxidase-like 2 Gene [Source:MGI Symbol;Acc:MGI:2137913]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34884 Nonsense Mutation detected in F1 DNA During 2016
sa14076 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064613 Nonsense 87 737 1 13
Genomic Location (Zv9):
Chromosome 10 (position 20526496)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20487910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTGGCTTCTTGGGCGCTGTCGCTTGGTCTCCGTCTGCAAAGTTTGGA[C/T]AAGGAGAAGGTAGGCCAAAAGCTTATTGAAGATCCACTATGTACATATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064613 Nonsense 685 737 12 13
Genomic Location (Zv9):
Chromosome 10 (position 20490687)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20452101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCNCCTGACACGTCTCTTTCTGRCACACAGGTGGTAATCAATCCAAACTA[T/A]GACGTCGCTGAATCAGATTACACCAACAACGTCATGAAGTGCAAGTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link